miRBase entry: mmu-mir-188

Stem-loop mmu-mir-188


Accession
MI0000230
Symbol
MGI: Mir188
Description
Mus musculus mmu-mir-188 precursor miRNA
Gene family
MIPF0000113; mir-188

Literature search
36 open access papers mention mmu-mir-188
(259 sentences)

Sequence

6008 reads, 106 reads per million, 95 experiments
ucucaCAUCCCUUGCAUGGUGGAGGGugagcucucugaaaacccCUCCCACAUGCAGGGUUUGCAgga
(((..((..(((((((((..((((((....(.....).....))))))..)))))))))..))..)))

Structure
   ca  UC         GU      -ugag u 
ucu  CA  CCUUGCAUG  GGAGGG     c c
|||  ||  |||||||||  ||||||     | u
agg  GU  GGGACGUAC  CCUCcc     g c
   AC  UU         AC      caaaa u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chrX: 7247989-7248056 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from mmu-mir-188
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-188-5p

Accession MIMAT0000217
Description Mus musculus mmu-miR-188-5p mature miRNA
Sequence 6 - CAUCCCUUGCAUGGUGGAGGG - 26
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-188-3p

Accession MIMAT0004541
Description Mus musculus mmu-miR-188-3p mature miRNA
Sequence 45 - CUCCCACAUGCAGGGUUUGCA - 65
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009