miRBase entry: mmu-mir-203

Stem-loop mmu-mir-203


Accession
MI0000246
Symbol
MGI: Mir203
Description
Mus musculus mmu-mir-203 precursor miRNA
Gene family
MIPF0000108; mir-203

Literature search
103 open access papers mention mmu-mir-203
(758 sentences)

Sequence

196267 reads, 1022 reads per million, 101 experiments
gccugguccAGUGGUUCUUGACAGUUCAACAguucuguagcacaauuGUGAAAUGUUUAGGACCACUAGacccggc
(((.((((.(((((((((.((((.((((.(((((.((...)).))))))))).)))).))))))))).)))).)))

Structure
   u    c         U    G    A     c  u 
gcc gguc AGUGGUUCU GACA UUCA CAguu ug  
||| |||| ||||||||| |||| |||| ||||| || a
cgg ccaG UCACCAGGA UUGU AAGU Guuaa ac  
   c    A         U    A    -     c  g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 112130880-112130955 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-203
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-203-5p

Accession MIMAT0004547
Description Mus musculus mmu-miR-203-5p mature miRNA
Sequence 10 - AGUGGUUCUUGACAGUUCAACA - 31
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-203-3p

Accession MIMAT0000236
Description Mus musculus mmu-miR-203-3p mature miRNA
Sequence 48 - GUGAAAUGUUUAGGACCACUAG - 69
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009