Mmu-mir-206 is a microRNA that is found in mice [PMC4383946]. It has the same sequence as hsa-miR-206, which is found in humans [PMC4383946]. Mmu-mir-206 has been shown to be positively regulated by IGF1 treatment in combination with MAPK/ERK-inhibitor treatment, along with other myogenic markers [PMC4325962]. However, the downregulation of mmu-mir-206 by TNF-α was diminished when a MAPK/ERK inhibitor was applied, and myogenic marker expression was unaffected [PMC4325962]. The effect on miRNA processing seems to be miRNA-specific and precursor-specific [PMC4325962]. Mmu-mir-206 has been found to be inhibited by Rb1 treatment, with the most significant inhibitory effect on mmu-miR-134 [PMC9120625]. Mmu-mir-206 has also been associated with other genes and transcription factors after ovariectomy and orchiectomy in mice [PMC7074395]. The expression of mmu-mir-206 increases progressively with time of embryonic development in mice [PMC1635289]. It has also been shown to be involved in muscle cell differentiation and is associated with specific target genes such as Ezh2, Epha2, and Gja1 [PMC3753644]. The expression levels of mmu-mir-206 vary depending on age and muscle type in mice [PMC6250799]. TargetScanFish 6.2, TargetScan 7.2, and TargetScanMouse 7.2 have been used to analyze dre-miR-206-3p, hsa-miR-206, and mmu-mir-206 respectively[ PMC8055004].. In situ hybridization using a locked nucleic acid (LNA) detection probe has been performed to detect mmu-mir-206 [PMC3422271]. The levels of mmu-mir-206 can be inhibited or overexpressed using specific inhibitors or constructs [PMC3973319]. The numbers of constructs encoding mmu-mir-1-1, mmu-mir-1-2, and mmu-mir-206 in mice are 20, 6, and 6 respectively [PMC2613404].
- C U auau ccagg ccACAUGCUUCUUUAUAU C CAUAg c ||||| |||||||||||||||||| | ||||| u gguuu GGUGUGUGAAGGAAUGUA G GUauc c u A - acga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0017004 |
Description | Mus musculus mmu-miR-206-5p mature miRNA |
Sequence | 8 - ACAUGCUUCUUUAUAUCCUCAUA - 30 |
Evidence |
experimental
Illumina [4] |
Accession | MIMAT0000239 |
Description | Mus musculus mmu-miR-206-3p mature miRNA |
Sequence | 46 - UGGAAUGUAAGGAAGUGUGUGG - 67 |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
|