miRBase entry: hsa-mir-133a-1

Stem-loop hsa-mir-133a-1


Accession
MI0000450
Symbol
HGNC: MIR133A1
Description
Homo sapiens hsa-mir-133a-1 precursor miRNA
Gene family
MIPF0000029; mir-133

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR133A1 is a gene that encodes miR-133a1, a mature microRNA in humans. It is located at 18q11.2 [PMC3323546]. miR-133a is mainly expressed in muscles and plays a role in controlling the pathogenesis of insulin resistance [PMC7913585]. MIR133A1, along with MIR133A2, promotes muscle differentiation and expression during myogenesis [PMC5137429]. In glioma samples, MIR133A1 was found to be downregulated [PMC8634738]. It is also expressed during pluripotent stem cell differentiation into the cardiac lineage [PMC6828809]. MIR133A1 and MIR133A2 are involved in promoting pre-cardiac mesoderm while suppressing endodermal and neuroectodermal lineages [PMC6828809]. In the context of familial atrial fibrillation, genetic screening of the MIR133A1 gene was performed [PMC3599331]. Alterations in MIR133A1 were observed in pancreatic ductal adenocarcinoma patients [PMC9599289]. Overexpression of TF ESF1 downregulates miRNA MIR133A1 to upregulate the target gene EGFR in prostate tumors [PMC8840188]. Additionally, 11 genes were found to be common between two top 20 lists, including MIR133A1 [PMC6890825].

Literature search
384 open access papers mention hsa-mir-133a-1
(1856 sentences)

Sequence

29713 reads, 680 reads per million, 120 experiments
acaaugcuuugcuagAGCUGGUAAAAUGGAACCAAAUcgccucuucaauggaUUUGGUCCCCUUCAACCAGCUGuagcuaugcauuga
.((((((...((((.(((((((..((.((.((((((((............)))))))).)).))..))))))).))))...)))))).

Structure
a      uuu    g       AA  U  A        gccuc 
 caaugc   gcua AGCUGGU  AA GG ACCAAAUc     u
 ||||||   |||| |||||||  || || ||||||||      
 guuacg   cgau UCGACCA  UU CC UGGUUUag     u
a      uau    G       AC  C  C        guaac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr18: 21825698-21825785 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-133a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-133a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-133a-3p

Accession MIMAT0000427
Description Homo sapiens hsa-miR-133a-3p mature miRNA
Sequence 53 - UUUGGUCCCCUUCAACCAGCUG - 74
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-133a-5p

Accession MIMAT0026478
Description Homo sapiens hsa-miR-133a-5p mature miRNA
Sequence 16 - AGCUGGUAAAAUGGAACCAAAU - 37
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45