miRBase entry: hsa-mir-133a-2

Stem-loop hsa-mir-133a-2


Accession
MI0000451
Symbol
HGNC: MIR133A2
Description
Homo sapiens hsa-mir-133a-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR133A2 is a gene encoding the miR-133a2 microRNA, located on chromosome 20 at 20q13.33, and is one of the two genes responsible for the production of mature miR-133a in humans [PMC3323546]. This gene was found to have a copy number gain in approximately 7% of patients, indicating its potential involvement in disease [PMC4967895]. A specific variant, 79T > C MIR133A2, located outside the seed region of the mature miRNA, was identified and shown to affect miRNA duplex processing by altering the relative abundance of miR-133a-3p and miR-133a-5p strands [PMC3599331]. This variant leads to an increased relative abundance of miR-133a-5p without affecting target gene expression for miR-133a-3p [PMC3599331]. The presence of this MIR133A2 variant could potentially modify gene expression profiles in cardiac tissue and has been associated with a patient exhibiting atrial fibrillation [PMC3599331]. Additionally, this variant is positioned adjacent to the Drosha cleavage site in the stem-loop structure at the 3′ end of miR-133a, which could have implications for its processing and function [PMC3599331].

Literature search
381 open access papers mention hsa-mir-133a-2
(1828 sentences)

Sequence

29569 reads, 247 reads per million, 119 experiments
gggagccaaaugcuuugcuagAGCUGGUAAAAUGGAACCAAAUcgacuguccaauggaUUUGGUCCCCUUCAACCAGCUGuagcugugcauugauggcgccg
.((.(((((((((...((((.(((((((..((.((.((((((((.(........).)))))))).)).))..))))))).))))...)))))..)))).)).

Structure
g  a    --     uuu    g       AA  U  A        g cug 
 gg gcca  aaugc   gcua AGCUGGU  AA GG ACCAAAUc a   u
 || ||||  |||||   |||| |||||||  || || |||||||| |    
 cc cggu  uuacg   cgau UCGACCA  UU CC UGGUUUag u   c
g  g    ag     ugu    G       AC  C  C        g aac 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1] later verified in human [2].

Genome context
chr20: 62564912-62565013 [+]

Disease association
hsa-mir-133a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-133a-3p

Accession MIMAT0000427
Description Homo sapiens hsa-miR-133a-3p mature miRNA
Sequence 59 - UUUGGUCCCCUUCAACCAGCUG - 80
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-133a-5p

Accession MIMAT0026478
Description Homo sapiens hsa-miR-133a-5p mature miRNA
Sequence 22 - AGCUGGUAAAAUGGAACCAAAU - 43
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45