Stem-loop sequence hsa-mir-153-1

AccessionMI0000463 (change log)
Symbol HGNC:MIR153-1
DescriptionHomo sapiens miR-153-1 stem-loop
Gene family MIPF0000050; mir-153
Literature search

69 open access papers mention hsa-mir-153-1
(680 sentences)

Stem-loop 
   c     g         -             -c       --   au 
5'  ucaca cugccagug ucauuuuugugau  ugcagcu  agu  u
    ||||| ||||||||| |||||||||||||  |||||||  |||   
3'  ggugu gacgguuac agugaaaacacug  acguuga  uca  c
   c     g         u             au       cc   cu
Get sequence
Deep sequencing
29077 reads, 69.3 reads per million, 137 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 219294111-219294200 [-]
antisense
OTTHUMT00000338161 ; VIL1-002; 3'UTR (exon 2)
OTTHUMT00000338162 ; VIL1-003; 3'UTR (exon 6)
OTTHUMT00000256778 ; VIL1-001; 3'UTR (exon 7)
ENST00000392114 ; VIL1-002; 3'UTR (exon 2)
ENST00000440053 ; VIL1-003; 3'UTR (exon 6)
ENST00000248444 ; VIL1-001; 3'UTR (exon 7)
Database links

Mature sequence hsa-miR-153-3p

Accession MIMAT0000439
Sequence

54 -  

uugcauagucacaaaagugauc

 - 75

Get sequence
Deep sequencing57962 reads, 132 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).