![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-153-1 |
|||||
Accession | MI0000463 (change log) | ||||
Symbol | HGNC:MIR153-1 | ||||
Description | Homo sapiens miR-153-1 stem-loop | ||||
Gene family | MIPF0000050; mir-153 | ||||
Literature search |
![]()
69 open access papers mention hsa-mir-153-1 | ||||
Stem-loop |
c g - -c -- au 5' ucaca cugccagug ucauuuuugugau ugcagcu agu u ||||| ||||||||| ||||||||||||| ||||||| ||| 3' ggugu gacgguuac agugaaaacacug acguuga uca c c g u au cc cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-153-3p |
|
Accession | MIMAT0000439 |
Sequence |
54 - uugcauagucacaaaagugauc - 75 |
Deep sequencing | 57962 reads, 132 experiments |
Evidence | experimental; cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|