miRBase entry: hsa-mir-188

Stem-loop hsa-mir-188


Accession
MI0000484
Symbol
HGNC: MIR188
Description
Homo sapiens hsa-mir-188 precursor miRNA
Gene family
MIPF0000113; mir-188

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR188 is a microRNA that is up-regulated in aged mice and humans and has been found to play a role in bone metabolism [PMC6158877]. It directly targets histone deacetylase 9 (Hdac9) and RPTOR independent companion of MTOR complex 2 (Rictor) mRNAs [PMC6158877]. Overexpression of MIR188 in osteoprogenitors leads to age-associated bone loss and fat accumulation in bone marrow, while mice lacking MIR188 show a decrease in age-associated bone loss and fat accumulation [PMC6158877]. The copy number and DNA methylation level at the MIR188 locus are minimally altered in STAD samples [PMC6537442]. The region upstream of the MIR188 locus contains several signal transducer and activator of transcription (STAT) binding sites, suggesting potential regulatory elements [PMC6537442]. Synthetic oligo RNAs targeting MIR188 were used for experimental purposes [PMC6353185]. MIR188 is specifically enriched in neurons but down-regulated in astrocytes [PMC6434090]. Real-time PCR was used to analyze the expression levels of GAPDH, Bcl-2, and MIR188 genes [PMC5242199]. Additionally, MIR188 has been implicated in Hcy-induced cardiac remodeling [PMC5147974]. Knocking out MIR188 reduces age-related cortical bone loss, trabecular bone loss, and marrow fat deposition in mice models [PMC8327488]. The genomic location of the rat MIR188 gene was determined to be upstream from the Clcn5 gene on the X-chromosome [PMC5052619]. miR532 inhibits TERT expression while miR168, miR397, and MIR188 are enhanced or suppressed depending on the plant species studied [PMC8253104]  . Finally, miR130a and miR149-3p promote osteogenic differentiation while MIR188 is involved in the age-related switch to adipogenesis in BMSCs [PMC9391248].

Literature search
58 open access papers mention hsa-mir-188
(327 sentences)

Sequence

6935 reads, 115 reads per million, 87 experiments
ugcucccucucucaCAUCCCUUGCAUGGUGGAGGGugagcuuucugaaaacccCUCCCACAUGCAGGGUUUGCAggauggcgagcc
.((((((..(((..((..(((((((((..((((((....(.....).....))))))..)))))))))..))..))).)).)))).

Structure
u    -  uc   ca  UC         GU      -ugag u 
 gcuc cc  ucu  CA  CCUUGCAUG  GGAGGG     c u
 |||| ||  |||  ||  |||||||||  ||||||     | u
 cgag gg  agg  GU  GGGACGUAC  CCUCcc     g c
c    c  -u   AC  UU         AC      caaaa u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 50003503-50003588 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-188
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-188 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-188-5p

Accession MIMAT0000457
Description Homo sapiens hsa-miR-188-5p mature miRNA
Sequence 15 - CAUCCCUUGCAUGGUGGAGGG - 35
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-188-3p

Accession MIMAT0004613
Description Homo sapiens hsa-miR-188-3p mature miRNA
Sequence 54 - CUCCCACAUGCAGGGUUUGCA - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52