WARNING: This summary was generated by AI. MIR188, a microRNA, is significantly up-regulated in aged mice and humans, suggesting a role in the aging process [PMC6158877]. It targets genes such as Hdac9 and Rictor that are implicated in bone metabolism [PMC6158877]. Overexpression of MIR188 in osteoprogenitors of transgenic mice leads to increased bone loss and fat accumulation in the bone marrow with aging, while mice deficient in MIR188 exhibit reduced age-related bone loss and fat accumulation [PMC6158877]. Despite these findings, alterations in the copy number and DNA methylation level at the MIR188 locus are infrequent in stomach adenocarcinoma (STAD) samples [PMC6537442]. Additionally, MIR188 is involved in homocysteine-induced cardiac remodeling [PMC5147974] and has been identified as a key regulator of age-related adipogenesis switch in bone marrow stromal cells (BMSCs) [PMC9391248]. The genomic location of the MIR188 gene has been mapped to approximately 50 kb upstream from the Clcn5 gene on the X-chromosome [PMC5052619], with potential regulatory elements identified upstream of its locus that could influence its expression [PMC6537442].
u - uc ca UC GU -ugag u gcuc cc ucu CA CCUUGCAUG GGAGGG c u |||| || ||| || ||||||||| |||||| | u cgag gg agg GU GGGACGUAC CCUCcc g c c c -u AC UU AC caaaa u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000457 |
| Description | Homo sapiens hsa-miR-188-5p mature miRNA |
| Sequence | 15 - CAUCCCUUGCAUGGUGGAGGG - 35 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004613 |
| Description | Homo sapiens hsa-miR-188-3p mature miRNA |
| Sequence | 54 - CUCCCACAUGCAGGGUUUGCA - 74 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|