In a study, it has been observed that there are different miRNA expressions between GF and colonized animals, specifically involving the CREB and Ras/MAPK pathways, with a significant role of MIR190A in the MGB axis [PMC8615526]. The downregulation of miRNAs involved in extracellular matrix remodeling, including MIR190A, has been linked to the early onset of fibrosis in double-infected transplanted livers [PMC8869900]. MIR190A has been shown to facilitate bladder cancer invasion and autophagy by stabilizing ATG7 mRNA through binding to its 3′UTR [PMC8514698]. The binding of MIR190A to the 3′-UTR of ATG7 mRNA has also been demonstrated in humans [PMC7226452]. Plasmids targeting ATG7, HNRNPD, and MIR190A were used in experiments [PMC6468970]. Ectopic expression of MIR190A promoted invasion of UMUC3 cells, while control expression did not have an effect on invasion [PMC6468970]. The study provided evidence supporting MIR190A as a critical mediator for ATG7 mRNA stabilization in human bladder cancer cells [PMC6468970]. The activity of ATG7 3′-UTR luciferase reporter was significantly increased by ectopic expression of MIR190A and inhibited by antisense targeting MIR190A [PMC6468970'>PMC6468970'>PMC6468970'>PMC6468970'>PMC6468970]. HNRNPD and ARHGDIB expressions were consistently observed in tumors obtained from xenograft nude mice injected with UMUC3 cells expressing different constructs [PMC6468970]. The inhibition or induction of autophagy had an effect on HNRNPD and ARHGDIB expression in UMUC3 cells expressing ectopic or antisense forms of MIR190A [PMC6468970]. Deficiency of MIR190A expression increased PHLPP1 protein expression and impaired ATG7 protein expression [PMC6468970]. MIR190A has been found to promote bladder cancer invasion and autophagy by stabilizing ATG7 mRNA [PMC6468970]. The upregulation of MIR190A has been observed in human bladder cancer tissues [PMC6468970].
u c u -U UA uuau gcagg c cugug GAUAUGUUUGAUAUAU GGUug u ||||| | ||||| |||||||||||||||| ||||| cguuc g gacaU UUAUACAAACUAUAUA UCaac u c u u CC -- cuaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000458 |
Description | Homo sapiens hsa-miR-190a-5p mature miRNA |
Sequence | 15 - UGAUAUGUUUGAUAUAUUAGGU - 36 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026482 |
Description | Homo sapiens hsa-miR-190a-3p mature miRNA |
Sequence | 52 - CUAUAUAUCAAACAUAUUCCU - 72 |
Evidence |
experimental
Illumina [3] |
Database links | |
Predicted targets |
|