![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cbr-mir-60 |
|||||
Accession | MI0000509 (change log) | ||||
Description | Caenorhabditis briggsae miR-60 stem-loop | ||||
Gene family | MIPF0000298; mir-60 | ||||
Stem-loop |
u ag - a a a cc 5' ucuug cuggaaag gug cauaa auc ugu a ||||| |||||||| ||| ||||| ||| ||| 3' agaac gaucuuuu cac guauu uag gca a c cu a - a c cg |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence cbr-miR-60 |
|
Accession | MIMAT0000479 |
Sequence |
46 - uauuaugcacauuuucuagucca - 68 |
Evidence | by similarity; MI0000031 |
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|