![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cbr-mir-81 |
||||||
Accession | MI0000519 (change log) | |||||
Description | Caenorhabditis briggsae miR-81 stem-loop | |||||
Gene family | MIPF0000154; mir-81 | |||||
Literature search |
1 open access papers mention cbr-mir-81 | |||||
Stem-loop |
c -u uc cu g --- auaa 5' guga uaacgg gguuuucac ugaucu aga gca c |||| |||||| ||||||||| |||||| ||| ||| 3' cacu auuguu ucgaaagug acuaga ucu cgu c u uc ga cu g auu aaga |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence cbr-miR-81 |
|
Accession | MIMAT0000488 |
Sequence |
57 - ugagaucaucgugaaagcuagu - 78 |
Evidence | by similarity; MI0000052 |
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|