Stem-loop sequence cbr-mir-87

AccessionMI0000523 (change log)
DescriptionCaenorhabditis briggsae miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention cbr-mir-87
(1 sentences)

Stem-loop 
   -  u    cccac     -       u     c u    a   -  - ugu 
5'  gg ugug     ccggc cgccuga acuuu g cuca ccu cg c   c
    || ||||     ||||| ||||||| ||||| | |||| ||| || |   a
3'  cc acac     ggccg guggacu ugaaa c gagu gga gc g   g
   a  c    ---aa     u       u     - -    -   u  u uaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrV: 8974017-8974111 [+]
intergenic
Database links

Mature sequence cbr-miR-87

Accession MIMAT0000492
Sequence

61 -  

gugagcaaaguuucaggugu

 - 80

Get sequence
Evidence by similarity; MI0000058

References

1
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).