miRBase entry: mmu-mir-129-2

Stem-loop mmu-mir-129-2


Accession
MI0000585
Symbol
MGI: Mir129-2
Description
Mus musculus mmu-mir-129-2 precursor miRNA
Gene family
MIPF0000073; mir-129

Literature search
58 open access papers mention mmu-mir-129-2
(616 sentences)

Sequence

176940 reads, 497 reads per million, 102 experiments
ugccuuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUucgcggagggcg
.((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))).

Structure
u             -       C   CU      ---     acau 
 gccuuucgcgaau CUUUUUG GGU  GGGCUU   GCugu    a
 ||||||||||||| ||||||| |||  ||||||   |||||     
 cgggaggcgcuUA GAAAAAC CCA  CCCGAA   cgaua    a
g             C       C   UU      ggc     acuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The miRNA from the 5' arm of this precursor was verified by cloning in mouse [1]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both mouse (this entry and MIR:MI0000222) and human (MIR:MI0000252 and MIR:MI0000473). Poy et al. independently cloned a mature miRNA from the 3' arm of the precursor, called mmu-miR-129-3p [3]. This sequence is not perfectly conserved in the other predicted mouse miR-129 precursor (MIR:MI0000222). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr2: 94241364-94241453 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-129-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-129-5p

Accession MIMAT0000209
Description Mus musculus mmu-miR-129-5p mature miRNA
Sequence 15 - CUUUUUGCGGUCUGGGCUUGC - 35
Evidence experimental
cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-129-2-3p

Accession MIMAT0000544
Description Mus musculus mmu-miR-129-2-3p mature miRNA
Sequence 57 - AAGCCCUUACCCCAAAAAGCAU - 78
Evidence experimental
cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009