Stem-loop mmu-mir-324

Accession

MI0000595

Symbol

MGI: Mir324

Description

Mus musculus mmu-mir-324 precursor miRNA mir-324

Gene
family

RF03479; mir-324

Literature search

25 open access papers mention mmu-mir-324
(78 sentences)

Sequence

27958 reads, 231 reads per million, 106 experiments

aacugacuaugccuccuCGCAUCCCCUAGGGCAUUGGUGUaaagcuggagacCCACUGCCCCAGGUGCUGCUggggguuguagucugac
....((((((((((((..(((.(.(((.(((((.(((.((..........))))).))))).))).).))).))))).)))))))....

Structure

aacu       -     uC   U C   A     U   U  aaag 
    gacuaug ccucc  GCA C CCU GGGCA UGG GU    c
    ||||||| |||||  ||| | ||| ||||| ||| ||     
    cugaugu ggggg  CGU G GGA CCCGU ACC ca    u
cagu       u     -U   C U   C     C   -  gagg 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000594) - expression of miRNAs from both arms was later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The predominant miR-324-3p clone has a 3' terminal U residue, which is incompatible with the genome sequence [3].

Genome context

chr11: 70012043-70012131 [+]

Mature mmu-miR-324-5p

• Accession: MIMAT0000555
• Description: Mus musculus mmu-miR-324-5p mature miRNA
• Sequence: 18 - CGCAUCCCCUAGGGCAUUGGUGU - 40
• Evidence: experimental ; cloned [2-3], Illumina [4-5]

Mature mmu-miR-324-3p

• Accession: MIMAT0000556
• Description: Mus musculus mmu-miR-324-3p mature miRNA
• Sequence: 53 - CCACUGCCCCAGGUGCUGCU - 72
• Evidence: experimental ; cloned [2], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365