Stem-loop mmu-mir-337

Accession

MI0000615

Symbol

MGI: Mir337

Description

Mus musculus mmu-mir-337 precursor miRNA

Gene family

MIPF0000195; mir-337

Literature search

16 open access papers mention mmu-mir-337
(58 sentences)

Sequence

26805 reads, 388 reads per million, 90 experiments

caguguagugagaaguuggggggugggaaCGGCGUCAUGCAGGAGUUGAUUgcacagccauUCAGCUCCUAUAUGAUGCCUUUcuucacccccuuca
.................((((((((((((.(((((((((.(((((((((.((......)).))))))))).))))))))).))).)))))))))...

Structure

caguguagugagaaguu         -   C         C         U  ca 
                 ggggggugg gaa GGCGUCAUG AGGAGUUGA Ug  c
                 ||||||||| ||| ||||||||| ||||||||| ||   
                 ucccccacu cUU CCGUAGUAU UCCUCGACU ac  a
--------------acu         u   U         A         u  cg 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000614). Seitz et al. later predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the hairpin, named here miR-337-5p and miR-337-3p [3].

Genome context

chr12: 109585789-109585885 [+]

Clustered miRNAs

13 other miRNAs are < 10 kb from mmu-mir-337

Mature mmu-miR-337-5p

• Accession: MIMAT0004644
• Description: Mus musculus mmu-miR-337-5p mature miRNA
• Sequence: 30 - CGGCGUCAUGCAGGAGUUGAUU - 51
• Evidence: experimental ; cloned [3], Illumina [4-5]

Mature mmu-miR-337-3p

• Accession: MIMAT0000578
• Description: Mus musculus mmu-miR-337-3p mature miRNA
• Sequence: 62 - UCAGCUCCUAUAUGAUGCCUUU - 83
• Evidence: experimental ; PCR [2], cloned [3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


5. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365