![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-339 |
|||||
Accession | MI0000621 (change log) | ||||
Symbol | MGI:Mir339 | ||||
Description | Mus musculus miR-339 stem-loop | ||||
Gene family | MIPF0000193; mir-339 | ||||
Literature search |
![]()
23 open access papers mention mmu-mir-339 | ||||
Stem-loop |
----------ac c au c cu - a -- u 5' ggggugg cacu c cuguc cc agg gcucac gua g ||||||| |||| | ||||| || ||| |||||| ||| 3' ccccacc gugg g gacag gg ucc cgagug cgu c caccugucacgu u cc a -c c g uc c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-339-5p |
|
Accession | MIMAT0000584 |
Previous IDs | mmu-miR-339 |
Sequence |
16 - ucccuguccuccaggagcucacg - 38 |
Deep sequencing | 20597 reads, 107 experiments |
Evidence | experimental; cloned [1], Illumina [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-339-3p |
|
Accession | MIMAT0004649 |
Sequence |
51 - ugagcgccucggcgacagagccg - 73 |
Deep sequencing | 5800 reads, 103 experiments |
Evidence | experimental; cloned [1], Illumina [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|