Stem-loop sequence mmu-mir-339

Accession

MI0000621 (change log)

Symbol

MGI:Mir339

Description

Mus musculus miR-339 stem-loop

Gene family

MIPF0000193; mir-339

Literature search

23 open access papers mention mmu-mir-339
(70 sentences)

Stem-loop

   ----------ac       c    au c     cu  -   a      --   u 
5'             ggggugg cacu  c cuguc  cc agg gcucac  gua g
               ||||||| ||||  | |||||  || ||| ||||||  |||  
3'             ccccacc gugg  g gacag  gg ucc cgagug  cgu c
   caccugucacgu       u    cc a     -c  c   g      uc   c 

Deep sequencing

26718 reads, 64.8 reads per million, 108 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr5: 139369650-139369745 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000091859 ; RP23-205J6.1-001; intron 2

  ENSMUST00000066052 ; 3110082I17Rik-001; intron 2

Database links

• EntrezGene:Mirn339
• MGI:Mir339
• RNAcentral:URS00006A63BC_10090
• miRBase Tracker:MI0000621

Mature sequence mmu-miR-339-5p

• Accession: MIMAT0000584
• Previous IDs: mmu-miR-339
• Sequence: 16 - ucccuguccuccaggagcucacg - 38
• Deep sequencing: 20597 reads, 107 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Database links:
  • RNAcentral:URS000003FD55_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-339-5p
  • miRDB:mmu-miR-339-5p
  • microrna.org:mmu-miR-339-5p

Mature sequence mmu-miR-339-3p

• Accession: MIMAT0004649
• Sequence: 51 - ugagcgccucggcgacagagccg - 73
• Deep sequencing: 5800 reads, 103 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]
• Database links:
  • RNAcentral:URS0000506376_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-339-3p
  • miRDB:mmu-miR-339-3p
  • microrna.org:mmu-miR-339-3p

References

1. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).