miRBase entry: mmu-mir-341

Stem-loop mmu-mir-341


Accession
MI0000625
Symbol
MGI: Mir341
Description
Mus musculus mmu-mir-341 precursor miRNA mir-341
Gene
family?
RF03771; mir-341

Literature search
8 open access papers mention mmu-mir-341
(30 sentences)

Sequence

46350 reads, 157 reads per million, 86 experiments
aaaaugaugaugucaguuggcCGGUCGGCCGAUCGCUCGGUCugucagucagucggUCGGUCGAUCGGUCGGUCGGUcagucggcuuccugucuuc
.....(((((.(((.((((((((((((((((((((.((((.(((.(.....).))))))).)))))))))))))))))))).))).))..)))...

Structure
aaaau   --  u   a                    C    U   u a 
     gau  ga guc guuggcCGGUCGGCCGAUCG UCGG Cug c g
     |||  || ||| |||||||||||||||||||| |||| ||| | u
     cug  cu cgg ugacUGGCUGGCUGGCUAGC GGCU ggc g c
--cuu   uc  u   c                    U    -   u a 


Annotation confidence Low
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000624) - its expression was later verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 109611500-109611595 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-341
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-341-5p

Accession MIMAT0017037
Description Mus musculus mmu-miR-341-5p mature miRNA
Sequence 22 - CGGUCGGCCGAUCGCUCGGUC - 42
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature mmu-miR-341-3p

Accession MIMAT0000588
Description Mus musculus mmu-miR-341-3p mature miRNA
Sequence 57 - UCGGUCGAUCGGUCGGUCGGU - 77
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365