miRBase entry: rno-mir-129-2

Stem-loop rno-mir-129-2


Accession
MI0000637
Description
Rattus norvegicus rno-mir-129-2 precursor miRNA
Gene family
MIPF0000073; mir-129

Literature search
27 open access papers mention rno-mir-129-2
(185 sentences)

Sequence

266214 reads, 370 reads per million, 417 experiments
agacugcccuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUucgcggagggcgcgc
....(((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))))...

Structure
agac              -       C   CU      ---     acau 
    ugcccuucgcgaau CUUUUUG GGU  GGGCUU   GCugu    a
    |||||||||||||| ||||||| |||  ||||||   |||||     
    gcgggaggcgcuUA GAAAAAC CCA  CCCGAA   cgaua    a
-cgc              C       C   UU      ggc     acuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. Kim et al [1] and He et al [4] both identify the mature product from the 3' arm, named miR-129* here.

Genome context
chr3: 83137297-83137393 [-]

Database links

Mature rno-miR-129-5p

Accession MIMAT0000600
Description Rattus norvegicus rno-miR-129-5p mature miRNA
Sequence 19 - CUUUUUGCGGUCUGGGCUUGC - 39
Evidence experimental
cloned [1-2], SOLiD [3]

Mature rno-miR-129-2-3p

Accession MIMAT0000601
Description Rattus norvegicus rno-miR-129-2-3p mature miRNA
Sequence 61 - AAGCCCUUACCCCAAAAAGCAU - 82
Evidence experimental
cloned [1,3-4], Northern [1], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714