Stem-loop sequence rno-mir-7a-1

AccessionMI0000641 (change log)
Previous IDsrno-mir-7;rno-mir-7-1
DescriptionRattus norvegicus miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

43 open access papers mention rno-mir-7a-1
(244 sentences)

Stem-loop 
   ugu      a  u        a     a       u      --     a 
5'    uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    accgga ca gguauacc ucuga cacuaaa caacag  gaauc a
   ucc      -  c        g     -       -      ca     a
Get sequence
Deep sequencing
64015 reads, 17.1 reads per million, 486 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. show that the 5' product is the predominant one [3]. The 3' product is renamed miR-7a*. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 6675016-6675112 [+]
sense
ENSRNOT00000025916 ; Hnrnpk-202; intron 14
ENSRNOT00000025980 ; Hnrnpk-201; intron 15
Database links

Mature sequence rno-miR-7a-5p

Accession MIMAT0000606
Previous IDsrno-miR-7;rno-miR-7a
Sequence

19 -  

uggaagacuagugauuuuguugu

 - 41

Get sequence
Deep sequencing102415 reads, 459 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-7a-1-3p

Accession MIMAT0000607
Previous IDsrno-miR-7*;rno-miR-7a*;rno-miR-7a-1*
Sequence

60 -  

acaacaaaucacagucugccau

 - 81

Get sequence
Deep sequencing12743 reads, 464 experiments
Evidence experimental; cloned [1,3], Northern [1], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).