![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-7a-1 |
|||||
Accession | MI0000641 (change log) | ||||
Previous IDs | rno-mir-7;rno-mir-7-1 | ||||
Description | Rattus norvegicus miR-7a-1 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
![]()
43 open access papers mention rno-mir-7a-1 | ||||
Stem-loop |
ugu a u a a u -- a 5' uggccu gu cugugugg agacu gugauuu guuguu uuuag u |||||| || |||||||| ||||| ||||||| |||||| ||||| 3' accgga ca gguauacc ucuga cacuaaa caacag gaauc a ucc - c g - - ca a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Landgraf et al. show that the 5' product is the predominant one [3]. The 3' product is renamed miR-7a*. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-7a-5p |
|
Accession | MIMAT0000606 |
Previous IDs | rno-miR-7;rno-miR-7a |
Sequence |
19 - uggaagacuagugauuuuguugu - 41 |
Deep sequencing | 102415 reads, 459 experiments |
Evidence | experimental; cloned [1-2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-7a-1-3p |
|
Accession | MIMAT0000607 |
Previous IDs | rno-miR-7*;rno-miR-7a*;rno-miR-7a-1* |
Sequence |
60 - acaacaaaucacagucugccau - 81 |
Deep sequencing | 12743 reads, 464 experiments |
Evidence | experimental; cloned [1,3], Northern [1], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|