miRBase entry: rno-mir-101b

Stem-loop rno-mir-101b


Accession
MI0000648
Description
Rattus norvegicus rno-mir-101b precursor miRNA
Gene family
MIPF0000046; mir-101

Literature search
22 open access papers mention rno-mir-101b
(174 sentences)

Sequence

704114 reads, 1821 reads per million, 500 experiments
aucugagacugaacuguccuuuuUCGGUUAUCAUGGUACCGAUGCuguagaucugaaaggUACAGUACUGUGAUAGCUGAAgaaugguggugccauc
......(((......)))..(((((((((((((((((((.(.((((............))))).)))))))))))))))))))(((((...))))).

Structure
aucugagacugaacuguccu                   C A    guaga 
                    uuuUCGGUUAUCAUGGUAC G UGCu     u
                    ||||||||||||||||||| | ||||      
                    agAAGUCGAUAGUGUCAUG C AUgg     c
------cuaccgugguggua                   A -    aaagu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr1: 247263723-247263819 [+]

Database links

Mature rno-miR-101b-5p

Accession MIMAT0017045
Description Rattus norvegicus rno-miR-101b-5p mature miRNA
Sequence 24 - UCGGUUAUCAUGGUACCGAUGC - 45
Evidence experimental
SOLiD [5]

Mature rno-miR-101b-3p

Accession MIMAT0000615
Description Rattus norvegicus rno-miR-101b-3p mature miRNA
Sequence 61 - UACAGUACUGUGAUAGCUGAA - 81
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68