miRBase entry: mmu-mir-101b

Stem-loop mmu-mir-101b


Accession
MI0000649
Symbol
MGI: Mir101b
Description
Mus musculus mmu-mir-101b precursor miRNA
Gene family
MIPF0000046; mir-101

Literature search
114 open access papers mention mmu-mir-101b
(837 sentences)

Sequence

956378 reads, 2519 reads per million, 107 experiments
aucugagacugaacugcccuuuuUCGGUUAUCAUGGUACCGAUGCUguagcucugaaagGUACAGUACUGUGAUAGCUgaagaauggcggugccauc
............((((((.((((((((((((((((((......((((((.((.....)).)))))))))))))))))))))))).))))))......

Structure
aucugagacuga      c                  ACCGAU      g  c 
            acugcc uuuuUCGGUUAUCAUGGU      GCUgua cu u
            |||||| ||||||||||||||||||      |||||| || g
            uggcgg aagaagUCGAUAGUGUCA      UGACAU ga a
------cuaccg      u                  ------      G  a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr19: 29135279-29135375 [+]

Database links

Mature mmu-miR-101b-5p

Accession MIMAT0017046
Description Mus musculus mmu-miR-101b-5p mature miRNA
Sequence 24 - UCGGUUAUCAUGGUACCGAUGCU - 46
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-101b-3p

Accession MIMAT0000616
Description Mus musculus mmu-miR-101b-3p mature miRNA
Sequence 60 - GUACAGUACUGUGAUAGCU - 78
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365