![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR156a |
|||||
Accession | MI0000653 (change log) | ||||
Description | Oryza sativa miR156a stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
122 open access papers mention osa-MIR156a | ||||
Stem-loop |
g - - a uguu uu aau 5' ggagg ugacaga agaga gugagcac cguggu ucc gcaua g ||||| ||||||| ||||| |||||||| |||||| ||| ||||| a 3' ccucc acugucu ucucu cacucgug gcaucg agg cguau u - c u c ---- uu ccg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR156a |
|
Accession | MIMAT0000618 |
Sequence |
7 - ugacagaagagagugagcac - 26 |
Deep sequencing | 560060 reads, 2 experiments |
Evidence | by similarity; MI0000183 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|