![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR162a |
|||||
Accession | MI0000667 (change log) | ||||
Previous IDs | osa-MIR162 | ||||
Description | Oryza sativa miR162a stem-loop | ||||
Gene family | MIPF0000169; MIR162_2 | ||||
Literature search |
![]()
29 open access papers mention osa-MIR162a | ||||
Stem-loop |
ugc gc u cc u c ---- gcugauccaggagcggcgaauuucuuugagaggg 5' gguga cugg gcag gguuuaucgauc uuccc gc uugu ggc u ||||| |||| |||| |||||||||||| ||||| || |||| ||| 3' ccgcu gacc cguc ccaaauagcuag aaggg cg aaca ccg g cuu ua u cu - c gcaa acguuguuccugguuuuccuucuuuuuuuuucuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR162a |
|
Accession | MIMAT0000632 |
Sequence |
143 - ucgauaaaccucugcauccag - 163 |
Deep sequencing | 667 reads, 2 experiments |
Evidence | by similarity; MI0000194 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|