![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR171a |
|||||
Accession | MI0000680 (change log) | ||||
Previous IDs | osa-MIR171 | ||||
Description | Oryza sativa miR171a stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
48 open access papers mention osa-MIR171a | ||||
Stem-loop |
--- a gc a c g ag 5' ggaa ga gauauuggug gguucaauc gau auugguuuuac c |||| || |||||||||| ||||||||| ||| ||||||||||| a 3' ccuu cu cuauaaccgc ccgaguuag cua ugacuaaaaug g ucu - -- g u - gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR171a |
|
Accession | MIMAT0000645 |
Sequence |
67 - ugauugagccgcgccaauauc - 87 |
Deep sequencing | 569 reads, 2 experiments |
Evidence | by similarity; MI0000214 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|