miRBase entry: mmu-mir-100

Stem-loop mmu-mir-100


Accession
MI0000692
Symbol
MGI: Mir100
Description
Mus musculus mmu-mir-100 precursor miRNA
Gene family
MIPF0000033; mir-10

Literature search
75 open access papers mention mmu-mir-100
(767 sentences)

Sequence

447302 reads, 870 reads per million, 92 experiments
ccuguugccacaAACCCGUAGAUCCGAACUUGUGcugauucugcacACAAGCUUGUGUCUAUAGGUAUgugucuguuagg
((((....((((.(((.((((((.(((.((((((.((......)))))))).))).)))))).))).)))).....))))

Structure
    -uugc    A   C      C   A      c  au 
ccug     caca ACC GUAGAU CGA CUUGUG ug  u
||||     |||| ||| |||||| ||| |||||| ||   
ggau     gugU UGG UAUCUG GUU GAACAc ac  c
    ugucu    A   A      U   C      -  gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000102) [1]. Its expression was later verified in mouse [3].

Genome context
chr9: 41531425-41531504 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-100
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-100-5p

Accession MIMAT0000655
Description Mus musculus mmu-miR-100-5p mature miRNA
Sequence 13 - AACCCGUAGAUCCGAACUUGUG - 34
Evidence experimental
cloned [3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-100-3p

Accession MIMAT0017051
Description Mus musculus mmu-miR-100-3p mature miRNA
Sequence 47 - ACAAGCUUGUGUCUAUAGGUAU - 68
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275