miRBase entry: mmu-mir-224

Stem-loop mmu-mir-224


Accession
MI0000711
Symbol
MGI: Mir224
Description
Mus musculus mmu-mir-224 precursor miRNA
Gene family
MIPF0000088; mir-224

Literature search
44 open access papers mention mmu-mir-224
(150 sentences)

Sequence

12653 reads, 87 reads per million, 79 experiments
gggcuuuUAAGUCACUAGUGGUUCCGUUuaguagaugguuugugcauuguuucaAAAUGGUGCCCUAGUGACUACAaagccc
(((((((..(((((((((.(((.((((((.(..((((.......))))....).)))))).))))))))))))..)))))))

Structure
       UA         U   U      a --ua    gu 
gggcuuu  AGUCACUAG GGU CCGUUu g    gaug  u
|||||||  ||||||||| ||| |||||| |    ||||  u
cccgaaA  UCAGUGAUC CCG GGUAAA c    uuac  g
       CA         -   U      a uuug    gu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Mouse mir-224 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000301) [1]. Its expression was later verified by cloning [3].

Genome context
chrX: 72261031-72261112 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-224
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-224-5p

Accession MIMAT0000671
Description Mus musculus mmu-miR-224-5p mature miRNA
Sequence 8 - UAAGUCACUAGUGGUUCCGUU - 28
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-224-3p

Accession MIMAT0017062
Description Mus musculus mmu-miR-224-3p mature miRNA
Sequence 55 - AAAUGGUGCCCUAGUGACUACA - 76
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73