miRBase entry: mmu-mir-124-2

Stem-loop mmu-mir-124-2


Accession
MI0000717
Symbol
MGI: Mir124a-2
Description
Mus musculus mmu-mir-124-2 precursor miRNA
Gene family
MIPF0000021; mir-124

Literature search
227 open access papers mention mmu-mir-124-2
(2523 sentences)

Sequence

889191 reads, 12551 reads per million, 77 experiments
aucaagaucagagacucugcucucCGUGUUCACAGCGGACCUUGAUuuaaugucauacaauUAAGGCACGCGGUGAAUGCCaagagcggagccuacggcugcacuugaa
.(((((..(((((.(((((((((..((((((((.(((..((((((((...........))))))))..))).))))))))..))))))))).))....)))..))))).

Structure
a     au   ----  a         cC        A   GA        uaau 
 ucaag  cag    ag cucugcucu  GUGUUCAC GCG  CCUUGAUu    g
 |||||  |||    || |||||||||  |||||||| |||  ||||||||    u
 aguuc  guc    uc gaggcgaga  CGUAAGUG CGC  GGAAUuaa    c
a     ac   ggca  c         aC        G   AC        caua 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MIR:MI0000716) on chromosome 14, mir-124-2 (MIR:MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MIR:MI0000150) on chromosome 2. All have closely related predicted human homologues (MIR:MI0000443, MIR:MI0000444 and MIR:MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context
chr3: 17795662-17795770 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-124-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-124-5p

Accession MIMAT0004527
Description Mus musculus mmu-miR-124-5p mature miRNA
Sequence 25 - CGUGUUCACAGCGGACCUUGAU - 46
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-124-3p

Accession MIMAT0000134
Description Mus musculus mmu-miR-124-3p mature miRNA
Sequence 62 - UAAGGCACGCGGUGAAUGCC - 81
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009