![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-9-3 |
||||||
Accession | MI0000721 (change log) | |||||
Symbol | MGI:Mir9-3 | |||||
Description | Mus musculus miR-9-3 stem-loop | |||||
Gene family | MIPF0000014; mir-9 | |||||
Literature search |
![]()
208 open access papers mention mmu-mir-9-3 | |||||
Stem-loop |
g cc - c g gu ca 5' gagg cguuucu cu uuugguuaucuagcu uauga gc c |||| ||||||| || ||||||||||||||| ||||| || 3' cucu guaaaga ga aagccaauagaucga auacu cg a a ca u - a gc ag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-9-5p |
|
Accession | MIMAT0000142 |
Previous IDs | mmu-miR-9 |
Sequence |
16 - ucuuugguuaucuagcuguauga - 38 |
Deep sequencing | 12049920 reads, 101 experiments |
Evidence | experimental; cloned [1-2,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-9-3p |
|
Accession | MIMAT0000143 |
Previous IDs | mmu-miR-9* |
Sequence |
55 - auaaagcuagauaaccgaaagu - 76 |
Deep sequencing | 447406 reads, 82 experiments |
Evidence | experimental; cloned [1,4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|