miRBase entry: hsa-mir-34b

Stem-loop hsa-mir-34b


Accession
MI0000742
Symbol
HGNC: MIR34B
Description
Homo sapiens hsa-mir-34b precursor miRNA
Gene family
MIPF0000039; mir-34

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR34B is a member of the miR34 family and has been observed to be present only in the MB436 cell line, which is a subtype of triple-negative breast cancer (TNBC) [PMC8261273]. The miR34 family, which includes miR34A, MIR34B, and miR34C, has been recognized as tumor suppressors and has been implicated in various cellular processes that control carcinogenesis [PMC4039115]. These processes include cell cycling, apoptosis, somatic cell reprogramming, and metastasis [PMC4039115]. The presence of MIR34B in the MB436 cell line suggests its potential role as a tumor suppressor in TNBC. The miR34 family's involvement in cellular processes that regulate carcinogenesis highlights its significance in cancer development and progression. Understanding the specific functions of MIR34B within these processes could provide valuable insights into TNBC pathogenesis and potential therapeutic targets. Further research is needed to elucidate the precise mechanisms by which MIR34B functions as a tumor suppressor and its potential implications for TNBC treatment [PMC4039115].

Literature search
463 open access papers mention hsa-mir-34b
(2668 sentences)

Sequence

3243 reads, 437 reads per million, 69 experiments
gugcucgguuugUAGGCAGUGUCAUUAGCUGAUUGuacuguggugguuaCAAUCACUAACUCCACUGCCAUcaaaacaaggcac
(((((..((((...(((((((...((((.((((((((((.....)).))))))))))))...)))))))....))))..)))))

Structure
     cg    -gUA       UCA    C        -  g 
gugcu  guuu    GGCAGUG   UUAG UGAUUGua cu u
|||||  ||||    |||||||   |||| |||||||| || g
cacgg  caaa    CCGUCAC   AAUC ACUAACau gg g
     aa    acUA       CUC    -        u  u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. The predominant mature miRNA in human is expressed from the 3' arm (in contrast to previous annotation) [2]. Both arms express mature products in mouse.

Genome context
chr11: 111512938-111513021 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-34b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-34b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-34b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-34b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-34b-5p

Accession MIMAT0000685
Description Homo sapiens hsa-miR-34b-5p mature miRNA
Sequence 13 - UAGGCAGUGUCAUUAGCUGAUUG - 35
Evidence not_experimental
Database links
Predicted targets

Mature hsa-miR-34b-3p

Accession MIMAT0004676
Description Homo sapiens hsa-miR-34b-3p mature miRNA
Sequence 50 - CAAUCACUAACUCCACUGCCAU - 71
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358