Stem-loop sequence cel-mir-354

AccessionMI0000753 (change log)
DescriptionCaenorhabditis elegans miR-354 stem-loop
Gene family MIPF0000238; mir-354
Literature search

2 open access papers mention cel-mir-354
(2 sentences)

Stem-loop 
            cuaagcaccuu  u     u       -    ucc  cuc  c   caua 
5' cagagccga           gg gcggc gcagacg ggua   gg   ga guu    c
   |||||||||           || ||||| ||||||| ||||   ||   || |||     
3' guuuugguu           cc cgucg uguuugu ccau   cc   cu cag    a
            ---------au  u     u       u    uuu  uuu  u   cacu
Get sequence
Deep sequencing
357 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing. The 5' end of the mature sequence ws mapped by PCR, but the 3' ends have not been experimentally determined.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 14468382-14468491 [-]
sense
Y105E8A.16.1 ; Y105E8A.16.1; 3'UTR (exon 4)
Y105E8A.16.2 ; Y105E8A.16.2; 3'UTR (exon 4)
Database links

Mature sequence cel-miR-354-5p

Accession MIMAT0031894
Sequence

21 -  

ggugcggcugcagacggguau

 - 41

Get sequence
Deep sequencing324 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-354-3p

Accession MIMAT0000696
Previous IDscel-miR-354
Sequence

80 -  

accuuguuuguugcugcuccu

 - 100

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; cloned [1], PCR [1]
Predicted targets

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).