Stem-loop sequence hsa-mir-383

Accession

MI0000791 (change log)

Symbol

HGNC:MIR383

Description

Homo sapiens miR-383 stem-loop

Gene family

MIPF0000137; mir-383

Literature search

31 open access papers mention hsa-mir-383
(288 sentences)

Stem-loop

      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 

Deep sequencing

5864 reads, 8 reads per million, 100 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 14853438-14853510 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000207636 ; SGCZ-001; intron 1

  ENST00000382080 ; SGCZ-001; intron 1

Database links

• EntrezGene:MIR383
• HGNC:MIR383
• RNAcentral:URS00004A6370_9606
• miRBase Tracker:MI0000791

Mature sequence hsa-miR-383-5p

• Accession: MIMAT0000738
• Sequence: 7 - agaucagaaggugauuguggcu - 28
• Deep sequencing: 5837 reads, 100 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00000C5969_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-383-5p.1
  • miRDB:hsa-miR-383-5p
  • microrna.org:hsa-miR-383-5p

Mature sequence hsa-miR-383-3p

• Accession: MIMAT0026485
• Sequence: 50 - acagcacugccuggucaga - 68
• Deep sequencing: 26 reads, 14 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:hsa-miR-383-3p
  • miRDB:hsa-miR-383-3p

References

1. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).