Stem-loop sequence mmu-mir-380

AccessionMI0000797 (change log)
Symbol MGI:Mir380
DescriptionMus musculus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Literature search

7 open access papers mention mmu-mir-380
(53 sentences)

Stem-loop 
         guu       ga       c   u 
5' aagaug   gaccaua  acaugcg uac u
   ||||||   |||||||  ||||||| |||  
3' uucuac   cugguau  uguaugc gug c
         -ac       ga       u   u
Get sequence
Deep sequencing
68178 reads, 253 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including a sequence from the 3' arm of this precursor [1]. Poy et al. cloned a sequence from the 5' arm from mouse pancreatic beta cell line MIN6 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109711803-109711863 [+]
antisense
ENSMUST00000175483 ; Gm25750-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-380
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-380-5p

Accession MIMAT0000744
Sequence

4 -  

augguugaccauagaacaugcg

 - 25

Get sequence
Deep sequencing36750 reads, 60 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-380-3p

Accession MIMAT0000745
Sequence

40 -  

uauguaguaugguccacaucuu

 - 61

Get sequence
Deep sequencing31427 reads, 67 experiments
Evidence experimental; Northern [1], PCR [1], cloned [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).