![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-380 |
||||||||||||||||||||||||||||||||||
Accession | MI0000797 (change log) | |||||||||||||||||||||||||||||||||
Symbol | MGI:Mir380 | |||||||||||||||||||||||||||||||||
Description | Mus musculus miR-380 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
7 open access papers mention mmu-mir-380 | |||||||||||||||||||||||||||||||||
Stem-loop |
guu ga c u 5' aagaug gaccaua acaugcg uac u |||||| ||||||| ||||||| ||| 3' uucuac cugguau uguaugc gug c -ac ga u u |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Comments |
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including a sequence from the 3' arm of this precursor [1]. Poy et al. cloned a sequence from the 5' arm from mouse pancreatic beta cell line MIN6 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-380-5p |
|
Accession | MIMAT0000744 |
Sequence |
4 - augguugaccauagaacaugcg - 25 |
Deep sequencing | 36750 reads, 60 experiments |
Evidence | experimental; cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-380-3p |
|
Accession | MIMAT0000745 |
Sequence |
40 - uauguaguaugguccacaucuu - 61 |
Deep sequencing | 31427 reads, 67 experiments |
Evidence | experimental; Northern [1], PCR [1], cloned [3], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|