miRBase entry: hsa-mir-328

Stem-loop hsa-mir-328


Accession
MI0000804
Symbol
HGNC: MIR328
Description
Homo sapiens hsa-mir-328 precursor miRNA
Gene family
MIPF0000203; mir-328

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR328 is a microRNA that has been found to play a role in various biological processes [PMC2361448]. It has been shown that a common upstream factor may control both MIR328 and miR15a to regulate GNG7 expression [PMC2361448]. In the context of chronic myeloid leukemia (CML), endogenous MIR328 knockdown induced imatinib resistance, while in-vitro delivery of alkalized exosomes, with or without exosomal MIR328, increased endogenous MIR328 levels and sensitized CML cells to imatinib [PMC7912829]. Additionally, MIR328 is reported as a regulator of untranslated PIM1 or other PIM kinases, along with the miR-1/206 cluster, miR33-5p, and miR486-5p [PMC8125027]. HNRNPK has been found to interact with several genes and non-coding RNAs including MIR328 [PMC9730017]. In the context of kidney disease, reduced expression of MIR328 was observed in UUO kidneys compared to normal kidneys [PMC4068774]. Furthermore, reduced levels of MIR328 were also found in diseased heart valves [PMC7197751]. Finally, in the context of traumatic brain injury (TBI), the diagnostic potential of several microRNAs including MIR328 was explored in cerebrospinal fluid and sera samples from patients experiencing different grades of TBI [PMC7327940].

Literature search
110 open access papers mention hsa-mir-328
(565 sentences)

Sequence

8042 reads, 88 reads per million, 119 experiments
uggaguGGGGGGGCAGGAGGGGCUCAGGGagaaagugcauacagcccCUGGCCCUCUCUGCCCUUCCGUccccug
.(((.((((((((((((.(((((.(((((.......((.....)))))))))))).)))))))))))))))....

Structure
---u   g            A     U     agaaagu  a 
    gga uGGGGGGGCAGG GGGGC CAGGG       gc u
    ||| |||||||||||| ||||| |||||       || a
    ccU GCCUUCCCGUCU UCCCG GUCcc       cg c
gucc   -            C     -     -------  a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
chr16: 67202321-67202395 [-]

Database links

Mature hsa-miR-328-3p

Accession MIMAT0000752
Description Homo sapiens hsa-miR-328-3p mature miRNA
Sequence 48 - CUGGCCCUCUCUGCCCUUCCGU - 69
Evidence experimental
cloned [3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-328-5p

Accession MIMAT0026486
Description Homo sapiens hsa-miR-328-5p mature miRNA
Sequence 7 - GGGGGGGCAGGAGGGGCUCAGGG - 29
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45