miRBase entry: hsa-mir-345

Stem-loop hsa-mir-345


Accession
MI0000825
Symbol
HGNC: MIR345
Description
Homo sapiens hsa-mir-345 precursor miRNA mir-345
Gene
family?
RF01044; mir-345

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR345 is a microRNA implicated in various cancer-related processes, including cell proliferation and invasion, particularly in colorectal cancer, where its expression is down-regulated due to methylation sensitivity [PMC3383700]. It is produced following signal transduction initiated by the binding of SDF1 to CXCR4 in astrocytes [PMC7795138]. In pancreatic cancer tissues, MIR345 is one of the miRNAs found to be differentially expressed, suggesting a potential role for miRNA-based therapies [PMC7457762]. Additionally, MIR345 forms part of circRNA-miRNA-mRNA networks that may be relevant for understanding molecular interactions in cancer [PMC7312917]. Its expression is also reduced in colorectal cancer due to the hypermethylation of its promoter [PMC8910953], and it has been identified as a low-level expressed miRNA in tumor tissues or cells [PMC7797122], as well as being dose-dependently reduced following endothelial injury by oxLDL [PMC9199460]. In network analyses related to gastric cancer survival, MIR345 was identified as one of the significant factors [PMC5856436], and it has been recognized as a metastasis-suppressive gene alongside other protein-coding genes and microRNAs [PMC8484294]. Overexpression of MIR345 has been associated with malignant transformation and increased lesion severity during progression from leukoplakia to invasive oral squamous cell carcinoma (OSCC) [PMC3292026; PMC5596676]..

Literature search
39 open access papers mention hsa-mir-345
(137 sentences)

Sequence

30862 reads, 152 reads per million, 124 experiments
acccaaacccuaggucuGCUGACUCCUAGUCCAGGGCUCgugauggcugguggGCCCUGAACGAGGGGUCUGGAGgccuggguuugaauaucgacagc
...(((((((.((((((.(.(((((((.((.((((((((((........)))))))))).)).))))))).).)))))))))))))............

Structure
---------acc       u      G U       A  C          gau 
            caaaccc aggucu C GACUCCU GU CAGGGCUCgu   g
            ||||||| |||||| | ||||||| || ||||||||||    
            guuuggg uccgGA G CUGGGGA CA GUCCCGggug   g
cgacagcuauaa       -      G U       G  A          guc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1], later validated in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr14: 100307859-100307956 [+]

Disease association
hsa-mir-345 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-345-5p

Accession MIMAT0000772
Description Homo sapiens hsa-miR-345-5p mature miRNA
Sequence 18 - GCUGACUCCUAGUCCAGGGCUC - 39
Evidence experimental
cloned [3-4], Northern [3]
Database links
Predicted targets

Mature hsa-miR-345-3p

Accession MIMAT0022698
Description Homo sapiens hsa-miR-345-3p mature miRNA
Sequence 54 - GCCCUGAACGAGGGGUCUGGAG - 75
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365