miRBase entry: rno-mir-128-2

Stem-loop rno-mir-128-2


Accession
MI0000901
Description
Rattus norvegicus rno-mir-128-2 precursor miRNA
Gene family
MIPF0000048; mir-128

Literature search
17 open access papers mention rno-mir-128-2
(64 sentences)

Sequence

2998559 reads, 2284 reads per million, 494 experiments
ugugcagugggaagGGGGGCCGAUGCACUGUAAGAgagugaguagcaggucUCACAGUGAACCGGUCUCUUUcccuacuguguc
...((((((((.((((((((((...((((((..((((.(........).))))))))))...)))))))))).))))))))...

Structure
ugu        a          AUG      AA    g gag 
   gcaguggg agGGGGGCCG   CACUGU  GAga u   u
   |||||||| ||||||||||   ||||||  |||| |    
   ugucaucc UUUCUCUGGC   GUGACA  CUcu g   a
cug        c          CAA      --    g acg 


Annotation confidence High
Do you think this miRNA is real?
Comments
The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
chr8: 120378945-120379028 [-]

Database links

Mature rno-miR-128-3p

Accession MIMAT0000834
Description Rattus norvegicus rno-miR-128-3p mature miRNA
Sequence 52 - UCACAGUGAACCGGUCUCUUU - 72
Evidence experimental
cloned [1-4], Northern [1], SOLiD [5]

Mature rno-miR-128-2-5p

Accession MIMAT0017119
Description Rattus norvegicus rno-miR-128-2-5p mature miRNA
Sequence 15 - GGGGGCCGAUGCACUGUAAGA - 35
Evidence experimental
SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714