miRBase entry: rno-mir-138-2

Stem-loop rno-mir-138-2


Accession
MI0000911
Description
Rattus norvegicus rno-mir-138-2 precursor miRNA
Gene family
MIPF0000075; mir-138

Literature search
41 open access papers mention rno-mir-138-2
(184 sentences)

Sequence

1473041 reads, 1275 reads per million, 491 experiments
guugcugcAGCUGGUGUUGUGAAUCAGGCCGacgagcaacgcauccucuuacccgGCUAUUUCACGACACCAGGGUugcacc
..(((.((..(((((((((((((...(((((..(((.........))).....)))))..))))))))))))).)).)))..

Structure
gu   u  AG             UCA     ---ac   caa 
  ugc gc  CUGGUGUUGUGAA   GGCCG     gag   c
  ||| ||  |||||||||||||   |||||     |||   g
  acg UG  GACCACAGCACUU   UCGgc     cuc   c
cc   u  -G             -UA     ccauu   cua 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr19: 11149748-11149829 [-]

Database links

Mature rno-miR-138-5p

Accession MIMAT0000844
Description Rattus norvegicus rno-miR-138-5p mature miRNA
Sequence 9 - AGCUGGUGUUGUGAAUCAGGCCG - 31
Evidence experimental
cloned [1-4], Northern [1], SOLiD [5]

Mature rno-miR-138-2-3p

Accession MIMAT0017127
Description Rattus norvegicus rno-miR-138-2-3p mature miRNA
Sequence 56 - GCUAUUUCACGACACCAGGGU - 76
Evidence experimental
SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714