Stem-loop sequence rno-mir-139

Accession

MI0000913 (change log)

Description

Rattus norvegicus miR-139 stem-loop

Gene family

MIPF0000117; mir-139

Literature search

21 open access papers mention rno-mir-139
(335 sentences)

Stem-loop

   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 

Deep sequencing

125150 reads, 47 reads per million, 483 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr1: 166589545-166589612 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000026586 ; Pde2a-201; intron 2

Database links

• EntrezGene:Mir139
• miRBase Tracker:MI0000913

Mature sequence rno-miR-139-5p

• Accession: MIMAT0000845
• Previous IDs: rno-miR-139
• Sequence: 7 - ucuacagugcacgugucuccag - 28
• Deep sequencing: 122338 reads, 483 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-139-5p
  • miRDB:rno-miR-139-5p
  • microrna.org:rno-miR-139-5p

Mature sequence rno-miR-139-3p

• Accession: MIMAT0004735
• Sequence: 43 - uggagacgcggcccuguuggag - 64
• Deep sequencing: 2802 reads, 305 experiments
• Evidence: experimental; cloned [3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-139-3p
  • miRDB:rno-miR-139-3p
  • microrna.org:rno-miR-139-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).