![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-139 |
|||||
Accession | MI0000913 (change log) | ||||
Description | Rattus norvegicus miR-139 stem-loop | ||||
Gene family | MIPF0000117; mir-139 | ||||
Literature search |
![]()
21 open access papers mention rno-mir-139 | ||||
Stem-loop |
gug - u a g gg 5' uauucua cag gc cgugucuccagu u c ||||||| ||| || |||||||||||| | u 3' augaggu guc cg gcgcagaggucg a c -ca u c - g gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-139-5p |
|
Accession | MIMAT0000845 |
Previous IDs | rno-miR-139 |
Sequence |
7 - ucuacagugcacgugucuccag - 28 |
Deep sequencing | 122338 reads, 483 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-139-3p |
|
Accession | MIMAT0004735 |
Sequence |
43 - uggagacgcggcccuguuggag - 64 |
Deep sequencing | 2802 reads, 305 experiments |
Evidence | experimental; cloned [3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|