Stem-loop sequence ath-MIR169f

AccessionMI0000980 (change log)
DescriptionArabidopsis thaliana miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

34 open access papers mention ath-MIR169f
(157 sentences)

Stem-loop 
         u     a       ac       auu         a           uuuaaacccaaccgguuuaugaccauuga 
5' gggucu gcaug aggaaua  gaaugga   gagccaagg ugacuugccgg                             u
   |||||| ||||| |||||||  |||||||   ||||||||| |||||||||||                             u
3' cuuaga uguac uucuuau  cuugcuu   cucgguucc guugaacgguc                             u
         u     c       cu       cgu         a           ugugcuuaguugucuaacacuuacucugg
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 4805684-4805850 [-]
intergenic
Database links

Mature sequence ath-miR169f-5p

Accession MIMAT0000910
Previous IDsath-miR169f
Sequence

32 -  

ugagccaaggaugacuugccg

 - 52

Get sequence
Evidence experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

Mature sequence ath-miR169f-3p

Accession MIMAT0031898
Sequence

118 -  

gcaaguugaccuuggcucugc

 - 138

Get sequence
Evidence not experimental

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).