Stem-loop sequence ath-MIR169h

AccessionMI0000982 (change log)
DescriptionArabidopsis thaliana miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

34 open access papers mention ath-MIR169h
(160 sentences)

Stem-loop 
   u  uau        aug    c       --       c    g   -          u    u     -  uuuua     uauaua  a      cac  g 
5'  ca   aagagaaa   guga augaaga  augagaa uugu ugg uagccaagga gacu gccug cg     gacca      uc aagacu   uc a
    ||   ||||||||   |||| |||||||  ||||||| |||| ||| |||||||||| |||| ||||| ||     |||||      || ||||||   ||  
3'  gu   uucucuuu   cacu uacuucu  uacucuu aaca acu aucgguuccu cuga cggac gc     uuggu      ag uucuga   ag u
   g  uuu        --a    -       cu       -    a   u          -    -     u  --ugg     ----ug  a      --u  c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2,3]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 6695420-6695609 [-]
intergenic
Database links

Mature sequence ath-miR169h

Accession MIMAT0000913
Sequence

46 -  

uagccaaggaugacuugccug

 - 66

Get sequence
Evidence experimental; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).