Stem-loop sequence ath-MIR169i

Accession

MI0000983 (change log)

Description

Arabidopsis thaliana miR169i stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

34 open access papers mention ath-MIR169i
(160 sentences)

Stem-loop

        -a      aa       -u       u     uu  -          u    u      -c     -----gu        uuuagugucuuguuugaaguca 
5' gaagg  gauguc  agaugaa  agaagaa cauau  gg uagccaagga gacu gccuga  ucuuu       guaaaaug                      c
   |||||  ||||||  |||||||  ||||||| |||||  || |||||||||| |||| ||||||  |||||       ||||||||                       
3' cuucc  uuacag  ucuacuu  ucuucuu guaua  cc aucgguuccu cuga cggacu  agaaa       cguuuuac                      u
        ac      ac       uc       -     uu  u          -    -      au     aaauauu        caguaacgaacuauguugaaua 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr3: 9871960-9872165 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR169i

• ath-MIR169n: chr3: 9878540-9878754 [-]
• ath-MIR169m: chr3: 9878168-9878379 [-]
• ath-MIR169l: chr3: 9875893-9876103 [-]
• ath-MIR169k: chr3: 9875525-9875737 [-]
• ath-MIR169j: chr3: 9872333-9872553 [-]
• ath-MIR169i: chr3: 9871960-9872165 [-]

Database links

• RNAcentral:URS000025DE68_3702
• miRBase Tracker:MI0000983

Mature sequence ath-miR169i

• Accession: MIMAT0000914
• Sequence: 40 - uagccaaggaugacuugccug - 60
• Evidence: experimental; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).