Stem-loop sequence ath-MIR172c

AccessionMI0000991 (change log)
DescriptionArabidopsis thaliana miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

55 open access papers mention ath-MIR172c
(288 sentences)

Stem-loop 
           uuc  u    g                a  --a  -       uau  ---g       aa 
5' agcuacug   gc guug agcaucaucaagauuc ca   au caucaag   uc    uguaaau  a
   ||||||||   || |||| |||||||||||||||| ||   || |||||||   ||    |||||||   
3' ucggugac   cg cgac ucguaguaguucuaag gu   ua guaguuu   ag    guauuua  c
           uaa  u    g                a  aug  u       -uu  auua       cc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR172 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for APETALA2-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 3599776-3599908 [-]
intergenic
Database links

Mature sequence ath-miR172c

Accession MIMAT0000922
Sequence

98 -  

agaaucuugaugaugcugcag

 - 118

Get sequence
Evidence experimental; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).