Stem-loop sequence ath-MIR396a

Accession

MI0001013 (change log)

Description

Arabidopsis thaliana miR396a stem-loop

Gene family

MIPF0000047; MIR396

Literature search

29 open access papers mention ath-MIR396a
(263 sentences)

Stem-loop

   c       uc            c            a -u  -uu    uuuuuuuuuuuuucuuuugauaucucu 
5'  ucuguau  uuccacagcuuu uugaacugcaaa c  uc   caga                           u
    |||||||  |||||||||||| |||||||||||| |  ||   ||||                           a
3'  agacaua  agggugucgaaa aacuuggcguuu g  ag   gucu                           c
   c       ga            u            a uu  cuc    cuauacuucuuuuagugauaaaauacg 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr2: 4142323-4142473 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS0000228D18_3702
• miRBase Tracker:MI0001013

Mature sequence ath-miR396a-5p

• Accession: MIMAT0000944
• Previous IDs: ath-miR396a
• Sequence: 11 - uuccacagcuuucuugaacug - 31
• Evidence: experimental; 5'RACE [1-2], Northern [1], PCR [1], 454 [3], MPSS [3]

Mature sequence ath-miR396a-3p

• Accession: MIMAT0031908
• Sequence: 123 - guucaauaaagcugugggaag - 143
• Evidence: experimental; Illumina [5]

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5. PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).