![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR399a |
|||||
Accession | MI0001020 (change log) | ||||
Description | Arabidopsis thaliana miR399a stem-loop | ||||
Gene family | MIPF0000015; MIR399 | ||||
Literature search |
![]()
36 open access papers mention ath-MIR399a | ||||
Stem-loop |
aaau c a a a - c -u uu cu 5' g auuacagggua gaucucu uuggcagg aac cauua uuaga c ugcau c | ||||||||||| ||||||| |||||||| ||| ||||| ||||| | ||||| 3' c uaaugucccgu uuagagg aaccgucu uug gugau aauuu g acgua u ucuu u - a a a u uc uu uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR399a |
|
Accession | MIMAT0000951 |
Sequence |
93 - ugccaaaggagauuugcccug - 113 |
Evidence | experimental; PCR [1], 454 [2-3], MPSS [2], Illumina [4] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|