Stem-loop sequence ath-MIR399a

AccessionMI0001020 (change log)
DescriptionArabidopsis thaliana miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

36 open access papers mention ath-MIR399a
(192 sentences)

Stem-loop 
   aaau c           a       a        a   -     c     -u uu     cu 
5'     g auuacagggua gaucucu uuggcagg aac cauua uuaga  c  ugcau  c
       | ||||||||||| ||||||| |||||||| ||| ||||| |||||  |  |||||   
3'     c uaaugucccgu uuagagg aaccgucu uug gugau aauuu  g  acgua  u
   ucuu u           -       a        a   a     u     uc uu     uu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 10227073-10227195 [+]
intergenic
Database links

Mature sequence ath-miR399a

Accession MIMAT0000951
Sequence

93 -  

ugccaaaggagauuugcccug

 - 113

Get sequence
Evidence experimental; PCR [1], 454 [2-3], MPSS [2], Illumina [4]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).