Stem-loop sequence ath-MIR399b

AccessionMI0001021 (change log)
DescriptionArabidopsis thaliana miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

34 open access papers mention ath-MIR399b
(184 sentences)

Stem-loop 
   uc               c      a          c    cuuccaaauauacacauacauauaug 
5'   acuaguuuuagggcg cucucc uuggcagguc uuua                          a
     ||||||||||||||| |||||| |||||||||| ||||                          a
3'   uggucaaagucccgu gagagg aaccguccag aaau                          u
   cu               u      a          u    auuuagcuaguagccuuuaaaagcua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 23345377-23345511 [-]
intergenic
Database links

Mature sequence ath-miR399b

Accession MIMAT0000952
Sequence

105 -  

ugccaaaggagaguugcccug

 - 125

Get sequence
Evidence experimental; PCR [1], cloned [2-3], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).