![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR393a |
||||||
Accession | MI0001026 (change log) | |||||
Previous IDs | osa-MIR393 | |||||
Description | Oryza sativa miR393 stem-loop | |||||
Gene family | MIPF0000083; MIR393 | |||||
Literature search |
![]()
53 open access papers mention osa-MIR393a | |||||
Stem-loop |
u a u u uc - --------- cu u 5' ggggaagc uccaaagggaucgcau gaucc uca gcu cu cg cgcu c |||||||| |||||||||||||||| ||||| ||| ||| || || |||| c 3' cuccuucg agguuuuccuagcgua cuagg agu cga ga gc gcgg a u g - c -u c acaucugcu ug u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence osa-miR393a |
|
Accession | MIMAT0000957 |
Previous IDs | osa-miR393 |
Sequence |
11 - uccaaagggaucgcauugauc - 31 |
Deep sequencing | 176 reads, 2 experiments |
Evidence | by similarity; MI0001003 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|