Stem-loop sequence osa-MIR393a

Accession

MI0001026 (change log)

Previous IDs

osa-MIR393

Description

Oryza sativa miR393 stem-loop

Gene family

MIPF0000083; MIR393

Literature search

53 open access papers mention osa-MIR393a
(147 sentences)

Stem-loop

   u        a                u     u   uc   -  ---------  cu    u 
5'  ggggaagc uccaaagggaucgcau gaucc uca  gcu cu         cg  cgcu c
    |||||||| |||||||||||||||| ||||| |||  ||| ||         ||  |||| c
3'  cuccuucg agguuuuccuagcgua cuagg agu  cga ga         gc  gcgg a
   u        g                -     c   -u   c  acaucugcu  ug    u 

Deep sequencing

176 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context

• Coordinates (MSU7): Chr1: 2309149-2309263 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR393a

• osa-MIR5494: Chr1: 2317278-2317395 [-]
• osa-MIR393a: Chr1: 2309149-2309263 [-]

Database links

• miRBase Tracker:MI0001026

Mature sequence osa-miR393a

• Accession: MIMAT0000957
• Previous IDs: osa-miR393
• Sequence: 11 - uccaaagggaucgcauugauc - 31
• Deep sequencing: 176 reads, 2 experiments
• Evidence: by similarity; MI0001003
• Database links:
  • RNAcentral:URS00004A46D8_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).