![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR394 |
|||||
Accession | MI0001027 (change log) | ||||
Description | Oryza sativa miR394 stem-loop | ||||
Gene family | MIPF0000100; MIR394 | ||||
Literature search |
![]()
26 open access papers mention osa-MIR394 | ||||
Stem-loop |
ua - g - u c -uu auccuca ca 5' cug a aguucu uuggca u uguccaccucc gucga gaga g ||| | |||||| |||||| | ||||||||||| ||||| |||| 3' gau u ucgagg aaccgu a acggguggagg uaguu cucu a -g g g u c u uuc gucuaua aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR394 |
|
Accession | MIMAT0000958 |
Sequence |
14 - uuggcauucuguccaccucc - 33 |
Deep sequencing | 123 reads, 2 experiments |
Evidence | by similarity; MI0001005 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|