![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR408 |
|||||
Accession | MI0001080 (change log) | ||||
Description | Arabidopsis thaliana miR408 stem-loop | ||||
Gene family | MIPF0000102; MIR408 | ||||
Literature search |
![]()
24 open access papers mention ath-MIR408 | ||||
Stem-loop |
aag auu uu --gaagac --g u --- -------------------------- caa a auu uuuac uuaa 5' guuag ggua gcaaugaaa aaagc g aauga gagagaga cagggaa gcag gcaugg gag uaaaaca a ||||| |||| ||||||||| ||||| | ||||| |||||||| ||||||| |||| |||||| ||| ||||||| c 3' caauc ucau cguuauuuu uuucg c uuacu cucucucu gucccuu cguc cguacc cuc guuuugu g --g --g -- aagguaac aca u uuc cuuuauaucucuuuuuuucucccucg cuc a cau ----u cuca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR408-5p |
|
Accession | MIMAT0031915 |
Sequence |
53 - acagggaacaagcagagcaug - 73 |
Evidence | experimental; Illumina [5] |
References |
|
1 |
PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
Plant Cell. 16:2001-2019(2004).
|
2 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|
5 |
PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"
BMC Genomics. 14:701(2013).
|