![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR156g |
|||||
Accession | MI0001082 (change log) | ||||
Description | Arabidopsis thaliana miR156g stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
79 open access papers mention ath-MIR156g | ||||
Stem-loop |
auaacga c - a u cuuu u g 5' agg gaca gaagagagugagcac ca ggcu uuc agcau c ||| |||| ||||||||||||||| || |||| ||| ||||| 3' ucc cugu cuucucucauucgug gu ucga aag ucgua u ucucucg u u c c ---- c c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR156 family [1], subsequently verified in [2]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR156g |
|
Accession | MIMAT0001012 |
Sequence |
11 - cgacagaagagagugagcac - 30 |
Evidence | experimental; 454 [2], Illumina [3] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|