Stem-loop sequence ath-MIR156h

AccessionMI0001083 (change log)
DescriptionArabidopsis thaliana miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

80 open access papers mention ath-MIR156h
(780 sentences)

Stem-loop 
   augaaaa   u  a      -            -a     g uua      ag 
5'        aug ug cagaag aaagagagcaca  ccugg a   gcaaaa  a
          ||| || |||||| ||||||||||||  ||||| |   ||||||   
3'        uac ac gucuuc uuucucucgugu  gggcu u   cguuuu  u
   gcguuac   c  c      c            ga     g ucc      ga
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1], subsequently verified in [2]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 22597012-22597117 [-]
intergenic
Database links

Mature sequence ath-miR156h

Accession MIMAT0001013
Sequence

12 -  

ugacagaagaaagagagcac

 - 31

Get sequence
Evidence experimental; 454 [2], Illumina [3]

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).