![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR164c |
|||||
Accession | MI0001087 (change log) | ||||
Description | Arabidopsis thaliana miR164c stem-loop | ||||
Gene family | MIPF0000045; MIR164 | ||||
Literature search |
![]()
43 open access papers mention ath-MIR164c | ||||
Stem-loop |
ua u a a c cacaaaugaaaucgauc 5' acac ug uggag ag agggcacgugcgaa g |||| || ||||| || |||||||||||||| 3' ugug ac accuc uc ucuugugcacgcuu g uc c a a a uuauacuaguuguucau |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR164 family [1]. It is predicted to target mRNAs coding for NAC domain transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR164c-5p |
|
Accession | MIMAT0001017 |
Previous IDs | ath-miR164c |
Sequence |
11 - uggagaagcagggcacgugcg - 31 |
Evidence | experimental; 454 [2], Illumina [3] |
Mature sequence ath-miR164c-3p |
|
Accession | MIMAT0031916 |
Sequence |
74 - cacguguucuacuacuccaac - 94 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|