![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR172e |
|||||
Accession | MI0001089 (change log) | ||||
Description | Arabidopsis thaliana miR172e stem-loop | ||||
Gene family | MIPF0000035; MIR172 | ||||
Literature search |
![]()
54 open access papers mention ath-MIR172e | ||||
Stem-loop |
guaguc a c a aga u uu --- -uu c 5' gc gaugcagca cauuaagauuc ca gaug gg cccuu ugc ucg c || ||||||||| ||||||||||| || |||| || ||||| ||| ||| u 3' cg cuacgucgu guaguucuaag gu cuau cc gggaa acg agc c cauaaa a a g gag u uu aag ccu u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR172 family [1]. It is predicted to target mRNAs coding for APETALA2-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR172e-5p |
|
Accession | MIMAT0031918 |
Sequence |
13 - gcagcaccauuaagauucac - 32 |
Evidence | not experimental |
Mature sequence ath-miR172e-3p |
|
Accession | MIMAT0001019 |
Previous IDs | ath-miR172e |
Sequence |
95 - ggaaucuugaugaugcugcau - 115 |
Evidence | experimental; 5'RACE [2], 454 [3], Illumina [4] |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|